Human Variation & Race

The body's temperature is regulated and will react if the external temperature changes. In very cold climates, there is a constant danger of developing hypothermia which can result in death because of the rapid decline in core body temperature . In order to increasing the chance of survival, the body will constrict blood vessels thus pulling blood to important organs.  Because cold weather can cause hypothermia, the homeostasis may now be disrupted because it is much more difficult for oxygenated blood to flow to all parts of the body; overall slowing down the body. While the body tries to adjust to this colder temperature, germs are now able to spread for a moment, causing sickness. 

Short-term adaptation: 
Shivering can also cause a short-term warming effect. Shivering causes the muscles of the human’s body to increase activity. The increased muscle activity in shivering results in a boost of temporarily heat production.

Facultative adaptation: 
 The Hunting phenomenon is  an unusual reaction of digital blood vessels exposed to cold; vasoconstriction (narrowing of blood vessels near skin surface)  is alternated with vasodilation(dilating the peripheral blood vessels)  in irregular repeated sequences, in an apparent hunting of equilibrium of skin temperature. 

Developmental adaptation:
People who live in extremely cold environments benefit much more by having a stocky body with short appendages rather then a long lean body because the shorter body type is more efficient at maintaining body heat.  Since the shorter body type would have relatively less surface area compared to body mass their bodies might hold more fat as a result they can produce more heat in the colder climates where they live. 

Cultural adaptation: There are many ways humans can deal with the cold . Some effective cultural response to extremely cold temperatures is the use of insulating clothing, indoor fires, and even sleeping in family groups with bodies pushed up against each other. Some cultures even drink strong alcohol as a way to increase temporarily body heat. 

The benefits of studying human variation in regards to clines rather than other classifications is that they are less biased on the organizer's beliefs, more accurate, more holistic and give a wider view to humanity that can be seen as a spectrum of adaptations for specific niches. The information we gather from these kinds of explorations is useful because it illustrates an true depiction of human evolution and adaptation, rather than lumping people into categories over insignificant distinctions. This information can be used in a productive way by anthropologists to assist other groups of people who fall under the same niche. Adaptations one group has spearhead may be applicable to another group.  

The word “race” has undergone many different meanings. Race is a undependable organizational system for stereotyping the human race. In example #2, these adaptations are not race specific; therefore, race would stand for any population who lives in very cold territories. There are certain patterns among populations that are directly linked to environmental stress. Instead of assimilating the word “race” with skin color or nationalities, people should understand the biological adaptations as a whole, which are really related to the environment.

Language Post

Part1: Engage in a conversation for 15 minutes where you are not allowed to use any version of a symbolic language.

            I decided to try the non-verbal experiment on  my husband two year old niece, well I was babysitting. I did not tell my husband or niece about the experiment beforehand.  I found the non-verbal experiment to be fairly easy because both my husband and niece actually understood what I was trying to communicate. Ironically, my niece seemed to understand more of what I was trying to communicate  than my husband. My niece caught on very quickly and actually starting motioning for things along with me. My husband seemed to be confused  with my motions at first and kept asking me what I was doing, but eventually he was able to figured it out.

            If this experiment were to actually take place with two different cultures I suppose the culture that can communicate the simplest would be able to get more ideas conveyed to more groups of people. I also suppose the speaking culture may feel as though the culture that does not use symbolic language is more primate or less knowledgeable.  In our culture, there are individuals who have difficulty communicating with spoken language such as the deaf. As a culture we accept American Sign Language as a valid form of communication, which can be taught to anyone who wants  to learn another way to communicate.  

Part2: Spend 15 minutes communicating without any physical embellishments, i.e., no hand signals, no vocal intonation, no head, facial, or body movements.

            For the second part of the experiment I decided to have a conversation with my mother and sister. I had not see either my mom or sister in about 3 months which meant they wanted to catch on all of life's happenings. I did not tell my mom or sister about the experiment beforehand.  I found this experiment to be quiet challenging and  lasted maybe 10 mins.  When I started  speaking  with mom she almost immediately noticed that I was not communicating normally and asked if something was wrong. My sister on the other hand,  communicated that I didn't seem very interested in the conversation and started to get irritated we me . After the experiment I have concluded that non-speech language techniques are very important to how we communicate because they help define our emotions and  help give meaning to spoken words. Without non-speech language we are literally  just spouting out words. 

            People who are visually and hearing impaired  may have difficulty reading body language and non-speech language. An adaptive benefit of being able to read body language is being able to evaluate a person or situation,  i.e. a perceptive job applicant or a  hostile situation.  I do not feel that there is an environmental condition where there might be a benefit to not reading body language because body language is sub concise. Most of the time people do not even realize what they are conveying to the rest of the world,  which generally reveals a person's true feelings. 

Comparative Primate Blog

Lemurs are only found on the African island of Madagascar. The forest of Madagascar are often covered with epiphytes, mosses, and lichens. . Lemurs evolved to an arboreal lifestyle (living and feeding off of trees) when separated during early primate evolution. They don’t have a large amount competition for food. A lemurs diet consist typically of fruit, leaves, tree bark, and sap.  The dental formula for a Lemur is 2:1:3:3  Lemurs have 2- incisors,1- canines,3- premolars, and 3-molars in the upper and lower jaws of both the right and left sides, which totals 36 teeth. Since Lemurs have multiple teeth morphologies their dentition is considered to be heterodnet. Prosimians (a type of primate that include lemurs) have a tooth comb which is six teeth that are closely pushed together. Fruit eating Lemurs use their tooth-comb to pick out seeds from fruit. Leaf eating Lemurs have smaller tooth-combs then fruit eating Lemurs. 

Spider monkeys inhabit Central America, South America, and Mexico. All three regions have tropical environments. It is also home to the Amazon Rainforest. Spider Monkeys, like the Lemur, live an arboreal lifestyle. Spider monkeys stay near the tops of canopy trees. The trees serve as a defense from predators below. The spider monkeys diets consist mostly of fruit, bird eggs, insects, and seeds. Spider monkey teeth have evolved to adapt to their arboreal living;  for example, using their incisors to pick fruits off of trees.  The dental formula for a spider monkey is 2:1:3:3  They have 2 incisors, one canine, 3 pre molars, and 3 molars. Spider monkeys differ from Prosimians, in regard to their jaw and teeth. They have no hypoconulids(the distal, or fifth, cusp of a lower molar tooth)  on the first 2 lower molars. 

Baboons live mainly in Africa. Baboons generally prefer semiarid habitats, like savannas, but some live in tropical forests. The major requirements for any habitat seem to be water sources and safe sleeping places—either in tall trees or on cliff faces. Baboons eat fruits, grasses, roots, bark, and seeds. Baboons also eat rodents, birds and other meats. Since, baboons have such a varied diet, they are considered omnivorous. They have broad incisors, molars with high crowns, and low cusps. Baboons have powerful jaws, as well as long teeth. This trait helps to defend against predators, as well as compete for food. Baboons dental formula is 2:1:2:3. Baboons have 2 incisors, 1 canine, 2 premolars, and 3 molars. 

Southeast Asia is home to gibbons. The climate is warm, humid, and could be generally characterized as monsoonal. The trees of the region are tropical, and are abundant in fruit. Gibbons spend most of their time in trees and feed on fruit trees. They specifically enjoy eating figs, but also eat tree bark and leaves. Gibbon’s dental formula is 2:1:2:3, just as the baboons are. Gibbons have shortened jaws with long canine teeth. Their teeth also resemble that of great apes.

Chimpanzees inhabit both tropical forest and bordering savannas in Africa. The savannas have scattered trees with an arid climate. Chimpanzees are omnivores. While the vast bulk of the chimpanzee's diet is made up of plant foods including fruits, seeds, nuts, leaves and flowers, they will also eat insects and even larger animals that they have hunted and killed themselves. Chimpanzees have 32 teeth; 16 on upper jaw and 16 on bottom jaw. They use their molars to grind fruits and leaves. Their dental formula is 2.1.2.3, 2 incisors, 1 canine, 2 premolars, and 3 molars,  just as gibbons and baboons. 

Since they need to crush and grind leaves, animals that have a plant based diet, tend to have more molars which means a dental formula typically of 2:1:3:3.  Animals like the lemur and the spider monkey live in tropical rain forest and inhabit trees. Their plant based diet is abundant in their habitat which allows them to be less aggressive. However, animals that have a meat based diet, tend to be more aggressive because they must compete with other carnivorous animals.  Examples of these animals are chimpanzees, baboons and gibbons.  These animals also tend to have larger incisors and less molars which is typically a dental formula of  2:1:2:3. 

Analogy/Homology

Homology- Cheetahs and Lions

Cheetahs evolved 4-6millon years ago. They are part of the cat family and evolved from domestic cats, wildcats, and all the way back to saber-tooth cats. Cheetahs are the only members of the Acinonyx group. The cheetah lineage is a group of  cats with similar characteristics, slender with long limbs. Cheetahs have a distinctive skull and dental morphology making them unique and different from other cats.

Chloe Schneider. Cheetah - Favorite Living Organism Research Project BIO20I.

http://prezi.com/utugobboophu/cheetah-favorite-living-organism-research-project-bio20i/. 2014, July 03.

Lions are the most social of the cats, living in family groups called prides, consisting of four to twelve related adult females, their young, and one to six adult males. Adult male lions weigh between 300 and 500 pounds (135 and 225 kilograms), while the female weighs about 300 pounds (135 kilograms). Lions are a light tawny color with black markings on the abdomen, legs, ears, and mane. Lions live up to 15 years, reaching sexual maturity in their third year.

http://www.scienceclarified.com/Ex-Ga/Felines.html#ixzz36SxWSdm1

The Cheetah and the Lion both have tongues covered in papillae which they use to scrape the meat from their prey and groom themselves.

Lion

Cheetah

The common ancestor for the cheetah and the lion would have to be a mammal from the Feliodea/Aeluroidea Superfamily. Since the order for all the modern cats is Carnivora (meat eaters) a tongue with papilla would very useful  to remove the flesh from prey. If we move to the superfamily of Feliodea the animals become more "cat like" in characteristics before actually getting to the family of Felidae which is our modern cats.

Analogy- Cheetahs and Dogs

Domestic Dog

Dogs were probably the first tame animals. They have accompanied humans for some 10,000 years. Today humans have bred hundreds of different domestic dog breeds—some of which could never survive in the wild.  Despite their many shapes and sizes all domestic dogs are members of the same species—Canis familiaris.   Domestic dogs still share many behaviors with their wild relatives. Both defend their territories and mark them by urinating on trees, rocks, fence posts, and other suitable sites. Many pet dogs also bury bones or favorite toys for future use, just as their wild relatives sometimes bury a kill to secure the meat for later feasts.

Domestic Dog-Canis familiaris http://animals.nationalgeographic.com/animals/mammals/domestic-dog/

Cheetah and Domestic Dog- Being Friendly

Cheetah

A cheetah is part of the cat family. It was believed that they were part of the dog family. For many reasons, such as non-retractable claws which allow them to grip the ground in high speed chases. A dog's non-retractable claws help grip the ground as well. The dog like face. When you look at a cheetah's face compare it to a dog's. Also like dogs cheetah's are light weight which allows them to run like a dog for a certain distance, although a dog can't run 70 mph. What else makes a cheetah look like a dog, is that they have tear marks. Those tear marks prevent lots of sun glare from getting in the cheetahs eyes at high speed chases. Unlike lions, tigers ,jaguars, and leopards the cheetah has a flexible spine for running so fast.

Dog- Front Paws

A dog's paws are the shock absorbers of his foot and pastern (wrist). A dog is not as deft as a cat with his paws. He cannot clean himself or "grab" his prey like a cat can. Rather, a dog uses his paws to dig and scratch. Walking and running are really the best uses for a dog's paws. There are five pads on a dog's foot. One is on each of the four toes, and a larger pad is centered in the "palm" of the foot.
http://www.ehow.com/about_6397161_anatomy-dog-paws.html

Cheetah-back Paws

Cheetah  paws are less rounded and harder than other cats' which helps the cheetah make quick turns. Cheetah claws are semi-retractable and aid in acceleration. The "thumb" claw or dew claw (at right bottom) is positioned back of the other 4 and higher. This claw is used to hook prey during the chase.

http://www.cheetahspot.com/claws.php

Blog #2-DNA

ACGTACTTGTAAGCAAGCCCCAGTACCGCTATACTCTTAATCGCT

Charles Lyell- Darwin's greatest influence for the Theory of Natural Selection

Charles Lyell- Darwin's greatest influence for the 

Theory of Natural Selection 

            Charles Lyell is considered the founder of modern geology. Lyell was also a close friend and mentor to Darwin. Lyell gained praise for his published work for example Principles of Geology, where he argued for the theory of Uniformitarianism. Uniformitarianism is the theory  that the earth's features are the result of long term processes that continue to operate in the present just as they did in the past. After elaboration from Lyell, the theory opposed catastrophism and greatly contributed to the concept of immense geological time. Lyell also emphasized that for such slowly acting forces to produce momentous change, the earth must be much older than previously suspected.

            Darwin's method for evolution was natural selection through gradual change in the genome in reaction to factors pressuring from the environment. Geological gradualism and uniformitarianism, gave Darwin a geologic time frame in which his method of natural selection could operate. Charles Lyell elaborated on the theory of Uniformitarianism, which greatly contributed to the concept of immense geological time.  The small genetic differences and mutations that accumulated in an organism to shape the radical changes leading to the differentiation of new species needed constant environmental pressures over a long period of time. Gradualism and uniformitarianism allowed for both of these criteria and so influenced Darwin's theory of evolution by means of natural selection.

            Since Lyell was a mentor to Darwin, I believe that Darwin drew allot of inspiration from Lyell's ideas and concepts. Therefore, if not for Lyell and the theory of uniformitarianism Darwin would have had a very difficult time developing his method of evolution with natural selection.

            Darwin's book, On the Origin of Species, was very controversial because it not only contradicted what the church preached but also the Bible. Darwin knew that his book would be the first to challenge bible teachings. Wanting to avoid what happened to Galileo, Darwin avoided publishing his book until he felt confident in his ability to defend his work. Overall, the church had allot of influence on Darwin's work.

http://evolution.berkeley.edu/evolibrary/article/history_12