Blog #2-DNA

ACGTACTTGTAAGCAAGCCCCAGTACCGCTATACTCTTAATCGCT

Charles Lyell- Darwin's greatest influence for the Theory of Natural Selection

Charles Lyell- Darwin's greatest influence for the 

Theory of Natural Selection 

            Charles Lyell is considered the founder of modern geology. Lyell was also a close friend and mentor to Darwin. Lyell gained praise for his published work for example Principles of Geology, where he argued for the theory of Uniformitarianism. Uniformitarianism is the theory  that the earth's features are the result of long term processes that continue to operate in the present just as they did in the past. After elaboration from Lyell, the theory opposed catastrophism and greatly contributed to the concept of immense geological time. Lyell also emphasized that for such slowly acting forces to produce momentous change, the earth must be much older than previously suspected.

            Darwin's method for evolution was natural selection through gradual change in the genome in reaction to factors pressuring from the environment. Geological gradualism and uniformitarianism, gave Darwin a geologic time frame in which his method of natural selection could operate. Charles Lyell elaborated on the theory of Uniformitarianism, which greatly contributed to the concept of immense geological time.  The small genetic differences and mutations that accumulated in an organism to shape the radical changes leading to the differentiation of new species needed constant environmental pressures over a long period of time. Gradualism and uniformitarianism allowed for both of these criteria and so influenced Darwin's theory of evolution by means of natural selection.

            Since Lyell was a mentor to Darwin, I believe that Darwin drew allot of inspiration from Lyell's ideas and concepts. Therefore, if not for Lyell and the theory of uniformitarianism Darwin would have had a very difficult time developing his method of evolution with natural selection.

            Darwin's book, On the Origin of Species, was very controversial because it not only contradicted what the church preached but also the Bible. Darwin knew that his book would be the first to challenge bible teachings. Wanting to avoid what happened to Galileo, Darwin avoided publishing his book until he felt confident in his ability to defend his work. Overall, the church had allot of influence on Darwin's work.

http://evolution.berkeley.edu/evolibrary/article/history_12